|
New England Biolabs
plko 1 puro vector Plko 1 Puro Vector, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plko 1 puro vector/product/New England Biolabs Average 99 stars, based on 1 article reviews
plko 1 puro vector - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
TaKaRa
plko 1 puro vector Plko 1 Puro Vector, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plko 1 puro vector/product/TaKaRa Average 97 stars, based on 1 article reviews
plko 1 puro vector - by Bioz Stars,
2026-03
97/100 stars
|
Buy from Supplier |
|
Addgene inc
plko 1 puro vector Plko 1 Puro Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plko 1 puro vector/product/Addgene inc Average 96 stars, based on 1 article reviews
plko 1 puro vector - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
|
Millipore
plko.1-puro-cmv-turbogfp_shnon-target-vector Plko.1 Puro Cmv Turbogfp Shnon Target Vector, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plko.1-puro-cmv-turbogfp_shnon-target-vector/product/Millipore Average 90 stars, based on 1 article reviews
plko.1-puro-cmv-turbogfp_shnon-target-vector - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Addgene inc
plk0 1 trc puro Plk0 1 Trc Puro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plk0 1 trc puro/product/Addgene inc Average 96 stars, based on 1 article reviews
plk0 1 trc puro - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
|
Millipore
rin1-silencing short hairpin rna (shrna) lentivirus plko.1-puro vector Rin1 Silencing Short Hairpin Rna (Shrna) Lentivirus Plko.1 Puro Vector, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rin1-silencing short hairpin rna (shrna) lentivirus plko.1-puro vector/product/Millipore Average 90 stars, based on 1 article reviews
rin1-silencing short hairpin rna (shrna) lentivirus plko.1-puro vector - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Addgene inc
plko 1 puro lentiviral vectors Plko 1 Puro Lentiviral Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plko 1 puro lentiviral vectors/product/Addgene inc Average 95 stars, based on 1 article reviews
plko 1 puro lentiviral vectors - by Bioz Stars,
2026-03
95/100 stars
|
Buy from Supplier |
|
Ribobio co
lxrβshrna Lxrβshrna, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/lxrβshrna/product/Ribobio co Average 90 stars, based on 1 article reviews
lxrβshrna - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Addgene inc
grnas Grnas, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/grnas/product/Addgene inc Average 93 stars, based on 1 article reviews
grnas - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Millipore
mission shrna plasmid control vector with the insert: ccggcaacaagatgaagagcaccaactcgagttggtgctcttcatcttgttgttttt Mission Shrna Plasmid Control Vector With The Insert: Ccggcaacaagatgaagagcaccaactcgagttggtgctcttcatcttgttgttttt, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mission shrna plasmid control vector with the insert: ccggcaacaagatgaagagcaccaactcgagttggtgctcttcatcttgttgttttt/product/Millipore Average 90 stars, based on 1 article reviews
mission shrna plasmid control vector with the insert: ccggcaacaagatgaagagcaccaactcgagttggtgctcttcatcttgttgttttt - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Addgene inc
lentiviral control vector plko 1 puro gfp shrna ![]() Lentiviral Control Vector Plko 1 Puro Gfp Shrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/lentiviral control vector plko 1 puro gfp shrna/product/Addgene inc Average 95 stars, based on 1 article reviews
lentiviral control vector plko 1 puro gfp shrna - by Bioz Stars,
2026-03
95/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Journal of Virology
Article Title: The Cellular Protein Complex Associated with a Transforming Region of E1A Contains c-MYC
doi: 10.1128/JVI.02039-15
Figure Lengend Snippet: Effect of c-MYC depletion on E1A-Ras cooperative transformation. (A to C) HNK cells were infected with retroviral vectors that express the Δ178–238 E1A mutant and the activated H-Ras oncogene, along with lentiviral vectors that express specific shRNAs targeted against c-MYC (A), ENY2 (B), MAX (C), or GFP. The cells were then selected with puromycin. The foci were stained with crystal violet and counted (graphs). The transduction of retroviral vectors that expressed only E1A-12S-177-9 (Δ178–238) or H-Ras induced low numbers of lightly stained (with crystal violet) colonies that were readily distinguished and discarded during quantification. The activities of shRNA vectors in the downregulation of c-MYC (A), ENY2 (B), and MAX (C) were determined in HeLa cells with different lentiviral vectors and selection with puromycin (blots). (D) Western blot analysis of E1A and Ras proteins. Seventy-two hours after transduction with different retroviral vectors and shRNA lentiviral vectors, HNK cells were analyzed by Western blotting using the E1A Ab (M58) and Ras antibodies.
Article Snippet: The
Techniques: Transformation Assay, Infection, Mutagenesis, Staining, Transduction, shRNA, Selection, Western Blot