plko 1 puror expression vector Search Results


99
New England Biolabs plko 1 puro vector
Plko 1 Puro Vector, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 puro vector/product/New England Biolabs
Average 99 stars, based on 1 article reviews
plko 1 puro vector - by Bioz Stars, 2026-03
99/100 stars
  Buy from Supplier

97
TaKaRa plko 1 puro vector
Plko 1 Puro Vector, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 puro vector/product/TaKaRa
Average 97 stars, based on 1 article reviews
plko 1 puro vector - by Bioz Stars, 2026-03
97/100 stars
  Buy from Supplier

96
Addgene inc plko 1 puro vector
Plko 1 Puro Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 puro vector/product/Addgene inc
Average 96 stars, based on 1 article reviews
plko 1 puro vector - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

90
Millipore plko.1-puro-cmv-turbogfp_shnon-target-vector
Plko.1 Puro Cmv Turbogfp Shnon Target Vector, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko.1-puro-cmv-turbogfp_shnon-target-vector/product/Millipore
Average 90 stars, based on 1 article reviews
plko.1-puro-cmv-turbogfp_shnon-target-vector - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

96
Addgene inc plk0 1 trc puro
Plk0 1 Trc Puro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plk0 1 trc puro/product/Addgene inc
Average 96 stars, based on 1 article reviews
plk0 1 trc puro - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

90
Millipore rin1-silencing short hairpin rna (shrna) lentivirus plko.1-puro vector
Rin1 Silencing Short Hairpin Rna (Shrna) Lentivirus Plko.1 Puro Vector, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rin1-silencing short hairpin rna (shrna) lentivirus plko.1-puro vector/product/Millipore
Average 90 stars, based on 1 article reviews
rin1-silencing short hairpin rna (shrna) lentivirus plko.1-puro vector - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

95
Addgene inc plko 1 puro lentiviral vectors
Plko 1 Puro Lentiviral Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 puro lentiviral vectors/product/Addgene inc
Average 95 stars, based on 1 article reviews
plko 1 puro lentiviral vectors - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

90
Ribobio co lxrβshrna
Lxrβshrna, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lxrβshrna/product/Ribobio co
Average 90 stars, based on 1 article reviews
lxrβshrna - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

93
Addgene inc grnas
Grnas, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/grnas/product/Addgene inc
Average 93 stars, based on 1 article reviews
grnas - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

90
Millipore mission shrna plasmid control vector with the insert: ccggcaacaagatgaagagcaccaactcgagttggtgctcttcatcttgttgttttt
Mission Shrna Plasmid Control Vector With The Insert: Ccggcaacaagatgaagagcaccaactcgagttggtgctcttcatcttgttgttttt, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mission shrna plasmid control vector with the insert: ccggcaacaagatgaagagcaccaactcgagttggtgctcttcatcttgttgttttt/product/Millipore
Average 90 stars, based on 1 article reviews
mission shrna plasmid control vector with the insert: ccggcaacaagatgaagagcaccaactcgagttggtgctcttcatcttgttgttttt - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

95
Addgene inc lentiviral control vector plko 1 puro gfp shrna
Effect of c-MYC depletion on E1A-Ras cooperative transformation. (A to C) HNK cells were infected with retroviral vectors that express the Δ178–238 E1A mutant and the activated H-Ras oncogene, along with <t>lentiviral</t> vectors that express specific shRNAs targeted against c-MYC (A), ENY2 (B), MAX (C), or GFP. The cells were then selected with puromycin. The foci were stained with crystal violet and counted (graphs). The transduction of retroviral vectors that expressed only E1A-12S-177-9 (Δ178–238) or H-Ras induced low numbers of lightly stained (with crystal violet) colonies that were readily distinguished and discarded during quantification. The activities of shRNA vectors in the downregulation of c-MYC (A), ENY2 (B), and MAX (C) were determined in HeLa cells with different lentiviral vectors and selection with puromycin (blots). (D) Western blot analysis of E1A and Ras proteins. Seventy-two hours after transduction with different retroviral vectors and shRNA lentiviral vectors, HNK cells were analyzed by Western blotting using the E1A Ab (M58) and Ras antibodies.
Lentiviral Control Vector Plko 1 Puro Gfp Shrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lentiviral control vector plko 1 puro gfp shrna/product/Addgene inc
Average 95 stars, based on 1 article reviews
lentiviral control vector plko 1 puro gfp shrna - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

Image Search Results


Effect of c-MYC depletion on E1A-Ras cooperative transformation. (A to C) HNK cells were infected with retroviral vectors that express the Δ178–238 E1A mutant and the activated H-Ras oncogene, along with lentiviral vectors that express specific shRNAs targeted against c-MYC (A), ENY2 (B), MAX (C), or GFP. The cells were then selected with puromycin. The foci were stained with crystal violet and counted (graphs). The transduction of retroviral vectors that expressed only E1A-12S-177-9 (Δ178–238) or H-Ras induced low numbers of lightly stained (with crystal violet) colonies that were readily distinguished and discarded during quantification. The activities of shRNA vectors in the downregulation of c-MYC (A), ENY2 (B), and MAX (C) were determined in HeLa cells with different lentiviral vectors and selection with puromycin (blots). (D) Western blot analysis of E1A and Ras proteins. Seventy-two hours after transduction with different retroviral vectors and shRNA lentiviral vectors, HNK cells were analyzed by Western blotting using the E1A Ab (M58) and Ras antibodies.

Journal: Journal of Virology

Article Title: The Cellular Protein Complex Associated with a Transforming Region of E1A Contains c-MYC

doi: 10.1128/JVI.02039-15

Figure Lengend Snippet: Effect of c-MYC depletion on E1A-Ras cooperative transformation. (A to C) HNK cells were infected with retroviral vectors that express the Δ178–238 E1A mutant and the activated H-Ras oncogene, along with lentiviral vectors that express specific shRNAs targeted against c-MYC (A), ENY2 (B), MAX (C), or GFP. The cells were then selected with puromycin. The foci were stained with crystal violet and counted (graphs). The transduction of retroviral vectors that expressed only E1A-12S-177-9 (Δ178–238) or H-Ras induced low numbers of lightly stained (with crystal violet) colonies that were readily distinguished and discarded during quantification. The activities of shRNA vectors in the downregulation of c-MYC (A), ENY2 (B), and MAX (C) were determined in HeLa cells with different lentiviral vectors and selection with puromycin (blots). (D) Western blot analysis of E1A and Ras proteins. Seventy-two hours after transduction with different retroviral vectors and shRNA lentiviral vectors, HNK cells were analyzed by Western blotting using the E1A Ab (M58) and Ras antibodies.

Article Snippet: The lentiviral control vector pLKO.1-puro-GFP-shRNA (ID30323) was purchased from Addgene.

Techniques: Transformation Assay, Infection, Mutagenesis, Staining, Transduction, shRNA, Selection, Western Blot